Upregulation of p52-ZER6 (ZNF398) increases reactive oxygen species by suppressing metallothionein-3 in neuronal cells

  • Eunsang Kwag
  • , Soo Jeong Park
  • , Jee Ho Lee
  • , Ji Yeong Lee
  • , Rin Khang
  • , Joo Ho Shin

Research output: Contribution to journalArticlepeer-review

Abstract

ZNF398/ZER6 belongs to the Krüppel-associated box (KRAB) domain-containing zinc finger proteins (K-ZNFs), the largest family of transcriptional repressors in higher organisms. ZER6 exists in two isoforms, p52 and p71, generated through alternative splicing. Our investigation revealed that p71-ZER6 is abundantly expressed in the stomach, kidney, liver, heart, and brown adipose tissue, while p52-ZER6 is predominantly found in the stomach and brain. The role of p52-ZER6 in neurons has remained unclear. Leveraging open-source RNA-seq data, we identified metallothionein 3 (MT3) as a target gene of p52-ZER6 in mouse hippocampal neuronal HT-22 cells. Through chromatin immunoprecipitation assays, we identified the putative DNA-binding motif (CTAGGGGGGTTGTTATCTCTTTGG) of p52-ZER6 in the promoter region of MT3. Furthermore, we demonstrated an interaction between p52-ZER6 and estrogen receptor alpha (ERα) in the nucleus of SH-SY5Y cells, which led to the inhibition of p52-ZER6's DNA occupancy on the promoter of the MT3 gene. MT3 is a cysteine-rich, low molecular-weight protein known for reducing oxidative stress, reactive oxygen species (ROS), and metal toxicity. Our study revealed that overexpression of p52-ZER6 reduced the levels of MT3, increasing ROS levels, which was mitigated by co-overexpression of ERα. Notably, we also observed upregulation of p52-ZER6 and reduction of MT3 in the cortex of 5xFAD, an Alzheimer's disease (AD) mouse model. These findings suggest a potential pathological mechanism involving p52-ZER6-mediated ROS production in AD pathogenesis.

Original languageEnglish
Article number151316
JournalBiochemical and Biophysical Research Communications
Volume748
DOIs
StatePublished - 8 Feb 2025

Keywords

  • Alzheimer's disease (AD)
  • Estrogen receptor alpha (ERα)
  • Metallothionein 3 (MT3)
  • ZNF398/p52-ZER6

Fingerprint

Dive into the research topics of 'Upregulation of p52-ZER6 (ZNF398) increases reactive oxygen species by suppressing metallothionein-3 in neuronal cells'. Together they form a unique fingerprint.

Cite this