Corrigendum to “Ultrasensitive detection of 25-hydroxy vitamin D3 in real saliva using sandwich-type electrochemical aptasensor” [Sens. Actuators B Chem. 355 (2022) 131239](S0925400521018074)(10.1016/j.snb.2021.131239)

1. Some authors' affiliations were modified in February 2022. Accordingly, the modified author affiliations are attached to this corrigendum. Modified author affiliations Joohyung Park^a1, Minwoo Kim^a1, Woochang Kim^a, Seong jae Jo^b, Woong Kim^c, Chihyun Kim^a, Hyunjun Park^a, Wonseok Lee^d*, Jinsung Park^a** a. Department of Biomechatronic Engineering, College of Biotechnology and Bioengineering, Sungkyunkwan University, Suwon, 16419, South Koreab. Infectious Disease Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon 34141, South Koreac. Department of Mechanical Engineering, Hanyang University, Seoul 04763, South Koread. Department of Electrical Engineering, Korea National University of Transportation, Chungju 27469, Republic of Korea¹These authors contributed equally to this work. * Corresponding author. ** Corresponding author at: Department of Biomechatronic Engineering, College of Biotechnology and Bioengineering, Sungkyunkwan University, Suwon, 16419, South Korea. E-mail addresses: [email protected] (W. Lee), [email protected] (J. Park). 2. The authors used the vitamin D aptamer sequence by referring to the research paper of Gu group (Biosensors and Bioelectronics, Volume 88, 15 February 2017, Pages 174–180), but we apologize for not referring to the paper in materials and methods of this article. Accordingly, the ‘Modified materials and methods’ was attached to this corrigendum. The authors apologize once again for any inconvenience caused. Modified materials and methods 2.1. Chemicals and materials 1,6-hexanedithiol (HEX), Atto MB NHS-ester, dimethyl sulfoxide (DMSO), hydrogen peroxide (H₂SO₄), potassium hexacyanoferrate (II), (III) (K₃[Fe(CN)₆], K₄[Fe(CN)₆]), potassium chloride (KCl), iodobenzene diacetate, 1,4-Dithiothreitol (DTT), proteinase K from Tritirachium album, sodium dodecyl sulfate (SDS), calcium chloride (CaCl₂), phenylmethylsulfonyl fluoride (PMSF), and gelatin from bovine skin were purchased from Sigma-Aldrich. The nylon syringe filter was purchased from Whatman (Whatman, Maidstone, United Kingdom). Methoxyl-pyrazole-amine was purchased from Conju-Probe (San Diego, USA). Phosphate buffer solution (1 × PBS, pH 7.4), Tris-HCl buffer solution (pH 7.4), and Tris-EDTA buffer solution (pH 7.4) were purchased from Gibco (Paisley, UK). The 25OHVD3 aptamer was used with a sequence developed by the Gu's group (Bang Hyun Lee, Van Thuan Nguyen, and Man Bock Gu. Highly sensitive detection of 25-HydroxyvitaminD3 by using a target-induced displacement of aptamer, Biosensors and Bioelectronics. 88 (2017) 174–180). The aptamer was labeled at the 5-end with thiol for functionalization of molybdenum disulfide (MoS₂). Ultrapure distilled water (DW, 18.3 M) was used for preparing all solutions. The 25OHVD3 aptamer was additionally labeled for fluorescence microscopy at the 3′end with fluorescein ‎ (FITC). The sequences of the aptamers are as follows: 5′-Thiol-AGCAGCACAGAGGTCATGGGGGGTGTGACTTTGGTGTGCCTATGCGTGCTACGGAA-3′ and 5′-Thiol-AGCAGCACAGAGGTCATGGGGGGTGTGACTTTGGTGTGCCTATGCGTGCTACGGAA–FITC-3′.